World of Books - Find your book here
Histories of Peirene: A Corinthian Fountain in Three Millennia
Betsey Ann Robinson... Maria del Mare Ceballos and Oscar Hernandez for all of their efforts, and I recognize Emily Gangemi for her research, ... Lolos, Brenda Longfellow, Emily Mackil,Jayne Reinhard, Joseph Rife, Phil Sapirstein, Paul Scotton, and Ruth Siddall.
Journal
Kentucky. General Assembly. House of Representativeslison, from his wife Martha Ann Allison; Murry MeCalister, from his wife Elvira McCalister; Patience Ryon, from her husband G. W. ... That James Robinson be divorced from his wife Mary Ann Robinson. ... That the marriage contract heretofore existing between Lewis L. Fisher and Betsy Ann Fisher be, and the same is hereby, ...
The Craig Family: A Genealogical and Historical Notes about ...
Winchell McKendree CraigGeorge Washington Craig, was born June 25, 1858, in Nicholas County; married Betsy Ann Robinson, Dec. 25, 1879. She is a daughter of John Raymond and Betsy Ann (Hanna) Robinson and was born Oct. 10, 1861. Their children: Ida Ethel ...
Spectacular Disappearances: Celebrity and Privacy, 1696-1801
Julia H. FawcettAnn Arbor: University of Michigan Press, 1993. Robinson, Mary. A Letter to the Women of England and The Natural Daughter. Ed. Sharon Setzer. Peterborough, Ontario: Broadview, 2003. Robinson, Mary. Mary Robinson: Selected Poems.
Women, Dissent and Anti-Slavery in Britain and America, ...
Preview37 There are two biographies of Betsey Mix Cowles: Linda L. Geary, Balanced in the Wind: A Biography of Betsey Mix Cowles (Cranberry, NJ: Associated University Presses, 1989); and Donna Marie DeBlasio, 'Her Own Society: The Life and ...
Are there any Knoffs here?: an inquiry and some answers
Gerald Everett KnoffShe was married to Judson LeGrande Robinson on April 21, 1880, in a Methodist ceremony, he being born in May 1844, a son of Hubbard and Betsy Ann Robinson. According to the enumerator there were nine children; Roy, Arthur, Eva, ...
Tituba of Salem Village
Ann PetryWhen the reverend’s suggestible young daughter, Betsey, starts having fits, the townsfolk declare it to be the devil’s work. Suspicion falls on Tituba, who can read fortunes and spin flax into thread so fine it seems like magic.
Gullah Home Cooking the Daufuskie Way: Smokin' Joe Butter ...
Sallie Ann Robinson" In this enchanting book, Robinson presents the delicious, robust dishes of her native Sea Islands and offers readers a taste of the unique, West African-influenced Gullah culture still found there.
Studies in American Indian Literatures: Newsletter of the ...
More editionsJudith A. Ranta. The Life and Writings of Betsey Chamberlain: Native American Mill Worker. Boston: Northeastern University Press, 2003. 284 pp. Kim Lee Judith Ranta's book about the life of Betsey Guppey Chamberlain is divided into two ...
Kentucky Pioneer and Court Records: Abstracts of Early ...
Mrs. Harry Kennett McAdamsAnn E. Robinson, oldest daughter of J. C. and C. A. Robinson — Born June 2nd, 1834; baptized by Rev. Wm. H. Roper, of M. E. ... 20, 1789; died Aug. 28, 1827 Nancy Payne, daughter of John and Betsy, his wife, was born October 16, 1791.
Perl for Exploring DNA
Betsey Dexter DyerMark D. LeBlanc, Betsey Dexter Dyer. # ! /usr/bin/perl use strict; use warnings; my $DNA = "CCGATGCTACGATTTCATTCAGGTC" ; my $complement_DNA; print "5' $DNA 3' \n\n"; # note the use of 5' and 3' # call the subroutine with the $DNA ...
Robinson
Chris PetitRobinson is a persuader. He uses his voice to win and manipulate, and the narrator of this novel knows he would still fall for Robinson's charm.
Miscellaneous works of Robert Robinson: to which are ...
Robert RobinsonMr. Robert Robinson was born on the 8th. of October, 1735, at Swaff ham in the county of Norfolk.* His father Mr. Michael Robinson, a native of Scotland, was an exciseman ; his mother was the daughter of Mr. Robert Wilkin, of Mil- denhall, ...
When I Was A Child I Read Books
Marilynne RobinsonClear-eyed, eloquent and profoundly insightful, with these essays Robinson demonstrates once again why she is one of our best-loved writers. 'Like Wollstonecraft, Robinson's intellect is threatening.
The Teddy Robinson Storybook: Macmillan Classics Edition
Joan G. RobinsonTeddy Robinson has been enchanting readers since his first appearance in 1953. This new paperback edition of Joan G Robinson's classics story is gloriously illustrated with the author's original line drawings.
Organometallic Chemistry
Royal Soc ChemistryIU) 18; (1.1V) 7 Robinson, B.H. (4) 30 Robinson, G.H. (11) 64, 68, 80 Robinson, K.D. (2)213 Robl, C. (9) 37 Robson, D.A. (6) 37 Roby, J. (12) 8 Rockwell, J.J. ... IV ) 63; (7) 46 Rubcnstahl, T. (4) 50; (6) 44 Ruck-Braun, K. (2) 43; (6) 137 Rucffcr.
Early Records, Hampshire County, Virginia: Now West ...
Clara McCormack SageCULP, Ann — 3-22-1852; pr. 6-28-1852. 2 eh. .... 6 ch., 1 Jacob (Robert is Jacob's eldest son); 2-John, 3-Thomas, 4 Robinson (hus. Joel) ; 5 Crow ... 3-plus ch., 1-Betsy Ann, "youngest"; 2 Susan, 3-WilIiam Harrison, "other older children." Exec ...
Dissent Along the Borders of the Fourth World: Native ...
Annalyssa Gypsy MurphyJudith Ranta, The Life and Writings of Betsey Chamberlain: Native American Mill Worker (Boston: Northeastern University Press, 2003), 128. W Judith Ranta, The Life and Writings of Betsey Chamberlain: Native American Mill Worker (Boston: ...
Ann: (1833-1897)
Ruth Vitrano MerkelAnn's brothers were told, and they did--most of the time. This is Ann's story--the first in the series of six true stories about Adventist girls: Ann, Marilla, Grace, Ruth, Elaine, and Erin. Ann was born in 1833.
Joan Robinson
G. HarcourtThis section is based on Pervez Tahir's monograph, Making Sense of Joan Robinson on China, which he wrote when he was the 1990 Joan Robinson Memorial Lecturer at the Faculty of Economics and Politics, University of Cambridge.
The History of Baptism
Robert RobinsonRobert Robinson. terials for the History of the Dutch; American and other foreign Baptists. Mr. Robinson wrote very little during the last twelve months. The whole of the present volume, except the preface and the recapitulation was finished ...
Blue and Gold: Being a Record of the College Year, Published ...
More editions... 324 Robertson, Ed1 141 Robinson, Allan 262 Robinson, Charles 93 Robinson, Dick 274 Robinson, Ed 226 Robinson, ... Chris 240, 462 Rollin, John 388 Rolston , Brooke 234 Roman, Peter 244 Rcmm, Barbara 294 Rondon, Fernando . .... Siegel, Maria 106, 119, 130, 347 Siemer, Virginia 123 Sigal, Barbara 96, 356 Sigmond, Herbert 268 Signorelli, Charlotte 306 Sigoloff, Roberta 365 Silberstein, Gary .
Jackie Robinson in Quotes: The Remarkable Life of Baseball's ...
Danny Peary—Mary Kay Linge, Jackie Robinson: A Biography, 2007 “Blessed with speed and marvelous coordination, Robinson became an athletic standout at Muir Technical High School, although the scouts did not single him out immediately as a ...
South Western Reporter. Second Series: Cases Argued and ...
More editionsAppellant received 41% of the votes cast in the first primary and was to meet Kirby Robinson in a runoff election to be held in April, 1988. A political advisor of [ appellant's] met with Robinson and offered him the job of chief deputy if Robinson ...
The Hero Two Doors Down: Based on the True Story of ...
Sharon RobinsonIt's 1948 and some of his neighbors are against it. Steve knows this is wrong. His hero, Jackie Robinson, broke the color barrier in baseball the year before. Then it happens--Steve's new neighbor is none other than Jackie Robinson!
This Life, This World: New Essays on Marilynne Robinson’s ...
PreviewFassler, Joe. “Marilynne Robinson on Democracy, Reading, and Religion in America.” The Atlantic (May 16, 2012). n. pag. Web. 11 Aug. 2014. Fay, Sarah. “ Marilynne Robinson: The Art of Fiction No. 198.” Paris Review 186 (Fall 2008): 37–66.
A Companion to First Ladies
PreviewHis wife, Sara Tappan Doolittle Lawrence Robinson, was a distant relation of Jane's. Mrs. Pierce received letters from Mrs. Robinson and from Nancy Means Lawrence, Jane's aunt, which pleaded for the release of Dr. Robinson, whom the ...
American Hereford Record and Hereford Herd Book
American Hereford Cattle Breeders' AssociationKirbv Robinson & McDill Т. O. Kirby Robinson & McDill Т. O. Kirby Robinson & McDill Т. O. Kirbv Robinson & McDill Т. O. Kirbv Robinson &. McDill Т. O. Kirby Robinson &, McDill Т. O. Kirby Robinson & McDill Т. O. Kirbv Robinson &, McDill T. 0.
who called from an unknown number?